Science is Man's efforts to understand God's ways!

- Enjoy this article? Help vote it up the 'Vine.
- Public Discussion (164)
Science is Man's efforts of understanding God's ways!
- 1 vote
There is no god, only science. God was invented by man before we came to our senses and invented science.
- 8 votes
discovered science, not invented.
It is all really about trying to understand our place in the world.
- 5 votes
" God was invented by man before we came to our senses and invented science " Ahh yes a " New god " , for the New age?? right :-) 1 Cor 3: 18 Let no one be seducing himself: If anyone among YOU thinks he is wise in this system of things, let him become a fool, that he may become wise. 19 For the wisdom of this world is foolishness with God; for it is written: “He catches the wise in their own cunning.” 20 And again: “Jehovah knows that the reasonings of the wise men are futile.” 21 Hence let no one be boasting in men;
Eagle Averro. Off topic.
besides, quoting the bible to prove the bible is like drawing a unicorn to prove unicorns exist.
- 11 votes
...quoting the bible to prove the bible is like drawing a unicorn to prove unicorns exist.
That's a great line. I'll have to remember that one.
- 4 votes
lol it CUTS both ways so " quoting from a Science book to prove Science is "?? Cut your Nose to Spite YOUR face???
- 1 vote
" quoting from a Science book to prove Science is "?? Cut your Nose to Spite YOUR face???
Not quite. Science provides a network of peer-tested literature that proves via testing, building on past known facts, and continuous cross-checking for consistency. Any aberrations create new questions that become the basis for theories to be tested, either proving or disproving them, thereby adding to the well of knowledge. Science is those things known, religion consists of those things you wish to be true, but can't prove.
You want to stick to the seeded topic, EA?
To all others. Is there another lab in the world that has equipment that can test CERN's findings? What is the next step in verifying this result?
- 9 votes
Sky? you are the Editor on this thread? Seems you make a comment and when you do not like the responce you cry foul, or is it Fowl, Science has been proved wrong over and over and over again it is Fanatics that cannot accept change.
Sky,
I don't think so, if this came from the LHC, someone would have to build another LHC. There is nothing else like it in the rest of the world, largely because of the multiple billions of dollars required to build it. The collider at Argonne is very different and if it was built, the even larger than the LHC one that was supposed to be built in Texas would also have been quite different, though it may have been able to reproduce LHC. Moot point now because it was never built.
Anyways, this is turning into another religion fest, but I should have realized that from the title, so I am detracking.
- 3 votes
Just curious, do fundamentalist Christian schools have chemistry and physics laboratories in them? Wouldn't it be contradictory if they did? Maybe they just have chapels instead.
I was just thinking about some possibilities:
Alexander Graham Bell didn't invent the telephone, God did.
God dislodged the apple from the tree and dropped it on Newton's head.
Jonas Salk was the personification of Jesus in order to discover a way to prevent polio. Wait a second, Salk wasn't Christian, he was Jewish. Oh, but then so was Jesus.
Wow!!! We could post a great article about this topic!!!
- 4 votes
Science has been proved wrong over and over and over again
You have a fundamental misconception about what science is. Theories evolve as our understanding of the nature of the universe increases. Sometimes theories are thrown out completely in favor of a totally new approach. This does not mean that science has been proved wrong. The development of theories is the very nature of what science is.
it is Fanatics that cannot accept change.
It is fanatics that cling to an understanding of the nature of the universe as described by a book of uncertain origin despite mountains of evidence to the contrary.
- 6 votes
Umm.. they haven't proven anything. In fact, they only ruled out one potential error. They basically didn't correct over half the problems mentioned in the first test.. Isn't that fun? ... But no surprise to see a Christian fundamentalist jump the gun and make assertions..
- 8 votes
lol it CUTS both ways so " quoting from a Science book to prove Science is "??
Have you taken a Science course, ever?
I ask because the central idea in every course I took was "Please, research this yourself."
I've used this story quite a few times, but I always remember when we covered Gravity. We weren't just told "gravity is x at sea level." We were invited to perform the test ourselves. We understood the reasoning behind it, were invited to test it multiple times, and allowed to reach our own conclusion.
Science does this - it welcomes questions. It welcomes people to challenge it. The only thing it requires is that a person challenging something is completely open in what they're doing - so all can understand the process.
- 6 votes
sky dog,
Is there another lab in the world that has equipment that can test CERN's findings?
Fermilab has announced plans to replicate the experiment. They have the equipment to do it.
What is the next step in verifying this result?
Besides Fermilab, lots and lots of calculations and checking.
One of the 'hot' hypotheses right now is the synchronization of the clocks used in the experiment.
Faster-than-Light Neutrino Puzzle Claimed Solved by Special Relativity
The relativistic motion of clocks on board GPS satellites exactly accounts for the superluminal effect, says physicist..
Great diagram at that link makes the argument pretty clear. I mentioned packet spread in my post above. There are other ideas. Since the announcement, more than 80 papers hae been produced, trying to explain why/why not this happened.
Eventually, we'll know.
- 6 votes
PR,
thanks. Sounds like another 'cold fusion,' without the dissembling.
- 1 vote
Buzz of the Orient said, "Alexander Graham Bell didn't invent the telephone, God did"
Actually, God invented Alexander Graham Bell, and the rest is history.........
Science marches on; if this turns out to be the case (and neutrinos are, admittedly more than a bit strange) there are a lot of implications. I look forward to seeing the follow-on experiments. Good to have them being done at two separate labs.
- 5 votes
if this turns out to be the case
'If' is the operative word here. Several issues still need to be sorted out - things like packet spread, for example.
I have no doubt that this will finally be sorted out. That's the beauty of science. It's inherently self-correcting. But to claim that Einstein has been proven wrong is not only jumping the gun, it's highly unscientific.
Science just doesn't work like that.
- 12 votes
This is an old article.
There have since been 2-3 calling into doubt the preliminary results.
BTW, science isn't about chasing god. Science is about the truth and there is very little (read none) regarding any god(s).
- 5 votes
physicist:
Not only unscientific, but didn't he actually include in his theory ways for faster than light properties to be allowed? I am not an expert in the GTR, hell the tensor math of it gives me headaches lol, but I do remember reading about that.
- 2 votes
Jonathan:
I am not an expert in the GTR, hell the tensor math of it gives me headaches lol,
Headaches? You get only headaches? I have massive lobe explosions! This is why I will never have the honor of being any more than a lay student of science.
But even from my limited perspective, I disagree with declaring Einstein "wrong". He left the world with his work incomplete, as all scientists do - and other scientists pick up the work and carry it on.
- 2 votes
but didn't he actually include in his theory ways for faster than light properties to be allowed?
Absolutely, Jonathan.
Einstein said that a particle with mass (rest mass, to be completely accurate) couldn't accelerate to the speed of light, because it would require an infinite amount of energy to do so.
But faster-than-light is not prohibited by special relativity. For example, it's assumed that tachyons travel faster than light.
- 4 votes
Well, first,"Einstein's Wrong Again!" suggests that your understanding of how science works is... flawed. Newton did not show that Copernicus and Kepler were wrong, he improved on their theories to make more accurate predictions and increase our understanding; likewise, Einstein did not throw away Newton, he improved on Newton. If current experiments improve on Einstein, we will have a more thorough understanding. These are not intended to be eternal absolutes graven forever in stone!
Second, "We don't understand everything" does not mean "God did it!" and God's ways are impenetrable to mortal men. Let's talk about it in two hundred years, shall we?
- 8 votes
Why do you think HE put you on this planet?..............
May be you'll find out in another couple hundred years!
Why do you think HE put you on this planet?..............-
You believe that God put us on this planet. You don't know that he did.
May be you'll find out in another couple hundred years!
He might found out or he might not.
- 4 votes
I don't expect the Nobel committee will demand the return of his prize, would they?
- 3 votes
You are correct; even if these experiments do in fact invalidate a chunk of the GTOR, that's not the point. Einstein immeasurably contributed to human knowledge, but no level of knowledge is ever complete.
I look at it this way: Aristotle, Keppler, and Bohrs were all wrong (or at least incomplete) in their knowledge. But each was brilliant, and each advanced the sum total of human knowledge. We all, as the saying goes, stand on the shoulders of giants.
- 6 votes
funny thing is, when one considers WHO contributes to the betterment of mankind, it's the scientists, the men that have put aside the dogma of superstition. and when one considers WHO contributes to the shackling of human creativity, it's the religions.
Some day people like me will be a majority, and the current mythologies will take their place with the mythologies of the Norse, the Greeks, the Egyptians, etc, etc, etc. and not be replaced with yet more mind shackling beliefs.
- 8 votes
My comment was, of course, "tongue-in-cheek", but your responses are admirable.
- 4 votes
Science is man's best efforts to understand the world he lives in and to improve on it. Religion is man's attempt to protect himself from what he does not understand. Some say we don't need Science, some say we don't need Religion, I would like to agree with the latter but cannot, unfortunately, whilst Religion remains one of the largest contributing factors to conflict, many weak minded people need to believe in "something" as they are unable to fully believe in themselves or fathom the possibility that we are alone in this complicated world.
- 2 votes
Imagine there's no heaven
It's easy if you try
No hell below us
Above us only sky
Imagine all the people living for today
Imagine there's no countries
It isn't hard to do
Nothing to kill or die for
And no religion too
Imagine all the people living life in peace
You, you may say
I'm a dreamer, but I'm not the only one
I hope some day you'll join us
And the world will be as one
Imagine no possessions
I wonder if you can
No need for greed or hunger
A brotherhood of man
Imagine all the people sharing all the world
You, you may say
I'm a dreamer, but I'm not the only one
I hope some day you'll join us
And the world will live as one
John Lennon (like I needed to write that...)
- 5 votes
Why did such creativity have to be nipped in the bud, before it has even had the opportunity to grow to maturity? How much more, and greater, could have been created? I also think of Mozart, besides Lennon, when I say this.
By the way, for many of us, you need not have said more than just the one word "Imagine" to have thought about John Lennon.
- 3 votes
look at Mozarts life style " it all catches up " " chickens come home to roost "
Maybe if he didn't live that life of debauchery he wouldn't have been so creative?
It's interesting that experiments have proven that one's brain can function better when listening to the music of Mozart rather than that of other composers. I tell students that listening to rap while studying impedes their cognitive abilities, and they should listen to Mozart played quietly in the background to enhance their ability to comprehend and remember.
My opinion also comes from the experience of listening to certain classical music while reading a book. Whenever I think of the book, I think of that particular piece of music, and whenever I hear that music, I think of that book. I can recall both much better due to the combination rather than a book I read in silence or music I listened to without reading anything. Is it some kind of positive reinforcement?
Sorry Biotronics, I really went off on a tangent there.
- 2 votes
Only fools believe in gods. Throughout our history we have invented thousands of them. Is it now that we believe in the most popular one? Fools!
- 4 votes
I neither agree nor disagree with your comment, cjcold, but it is not an immature and ignorant comment to call persons who do not have the same beliefs as yourself "fools"? Why would you want to advertise?
- 3 votes
but it is not an immature and ignorant comment to call persons who do not have the same beliefs as yourself "fools"?
As far as completely discounting the possibility of some sort of supreme being, I believe that it is. The existence of such a being cannot be proven or disprove with certainty. I'm as irritated by Atheists that claim to know God does not exist as I am by Christians that claim to know that he (or she) does.
- 1 vote
Tell me, how convinced are you by " Cross species evolution "? and can be envision what can be classified as the " Ultimate evolution for Man"?
I am convinced that "cross species evolution" is the best conclusion based on the current evidence available. Time will tell if it will stand as we find new evidence and our insight into what ir means develops. As for the Biblical creation story, there is not a shred of evidence supporting it.
- 3 votes
I am convinced that "cross species evolution" is the best conclusion based on the current evidence available. The End
Due to inability to reasson
Due to inability to reasson
I guess when you can't come up with a reasonable response to an argument, insults are you are left with.
- 3 votes
Eagle, by "cross-species evolution", do you mean speciation (the origin of new species via evolution)?
If so, that has been observed.
There is on "ultimate evolution of man" in evolutionary theory. That's based on a common misunderstanding, and an old one. Evolution is not directed towards some final goal, it is just change in a population over time as a result of variation in heritable traits, selection, and drift.
- 5 votes
Belfrey Nice Thank you for reading what was posted. ok
1) Cross Species : what I means by that is the Idea that Mutations caused a change from one species to another, now mutational evolution is discounted by most.
2) Ultimate Evolution : the State where Man has Evolved to be ably to use Science to create Life at will, and also the ability to terraform astral bodies for those lifeforms.
And on the last point indeed the development cannot ceaseas long as that organism is alive since the niche will always undergo changes. But here is catch 22: For an organism to make the needed changes it need a FLUX: Pressure to make changes by the environment that organism inhabits, on the other hand, for an organism to be ably to successfully develop in a niche, the niche has to be stable so that any changes to the organism are advantageous to it, else the energy used will be more then that needed for survival so it will go extinct.
1) Cross Species : what I means by that is the Idea that Mutations caused a change from one species to another,
Well, that has been observed in extant organisms.
now mutational evolution is discounted by most.
Certainly not by biologists.
2) Ultimate Evolution : the State where Man has Evolved to be ably to use Science to create Life at will, and also the ability to terraform astral bodies for those lifeforms.
Ooookay.
And on the last point indeed the development cannot ceaseas long as that organism is alive since the niche will always undergo changes. But here is catch 22: For an organism to make the needed changes it need a FLUX: Pressure to make changes by the environment that organism inhabits, on the other hand, for an organism to be ably to successfully develop in a niche, the niche has to be stable so that any changes to the organism are advantageous to it, else the energy used will be less then that needed for survival so it will go extinct.
Evolutionary change (or extinction) is inevitable, yes. But it's not inherently directed towards "higher" forms.
- 3 votes
Well It is better to try and fail than not try at all!
That's what Science is all about, asking questions and looking for answers....
Did that come from "Better to have loved and lost than never to have loved at all."
- 1 vote
Try and fail, yes that brings back memories. Picture this... Science class, October of '88. I am given a faulty bunsen burner that I plug into one the gas lines piped to every table in the chemistry lab. The bunsen burner, unbeknownst to me, has a clogged orifice (some salts or something from a previous experiment). We are told to ignite our burners. While brining the safety match up to the burner, it ignites pushing a four foot flame toward the ceiling lamps, startling the hell out of me and fellow labcoat wearing geeks at the table. The burner falls over and torches through the feed line blowing a fireball the size of a laundry basket toward the (thankfully) empty aisle. I turned off the gas calmly and asked the teacher Mr. Ahmahdi for a bathroom pass to change my shorts.
Good times. Good times. ;-)
- 3 votes
I guess Einstein will be wrong billions and billions of times; once for every time a neutrino breaks the speed limit going down hill.
- 2 votes
Your Brain is a lot more intelligent then Most give it credit for, Try this :Glass od water Place spoon in it, what do YOU see when you view the Spoon from about 30 degree.
Does the spoon seem BENT, well you brain has calculated the SPEED ( Different to VELOCITY) of light and it is different in WATER , then it is in the ambient atmosphere , so do YOU trust YOUR Brain :-)
The graveyards are full of the bodies of really really smart people who thought they had proved Einstein wrong on general relativity. Until we start seeing even one independent laboratory confirm OPERA's findings, my skepticism remains high.
- 2 votes
Stop The Hypocrisy Faith is a wonderful things, it is faith that allows folk to go to work, it is faith that makes them think they will come home and see their family, yes faith is wonderful, but a faith in Einstein as a " god " needs to be medicated :-)
@Eagle Averro: Which part of "Until we start seeing even one independent laboratory confirm OPERA's findings ..." are we having trouble with today? As Saint Ronnie famously said, "Trust but verify".
- 2 votes
I think at some point GTR will be proven to have limitations, just like Newtonian physics does, and I am pretty sure that Einstein believed that as well (that is the nature of science, continued exploration and learning). All it is going to do is create limits in where we use GTR and where we use a new theory.
We still teach Newtonian physics, (classical physics is Newtonian), even after it has been proven to not be complete.
- 3 votes
" Which part of "Until we start seeing even one independent laboratory confirm OPERA's findings ..." are we having trouble with today? As Saint Ronnie famously said, "Trust but verify". "
Ok Which part of " theory " do you not comprehend, Einstein postulated a THEORY, it is not accepted totally YET, a Theory is to be questioned, but it seems to me that you have accepted all that Einstein says because you have Idolized the MAN, is that right?
Now if you want to talk about Science FACTS, are YOU aware of many tests that have " Slowed and STOPPED light " and do YOU know the difference between Speed and Velocity?
1)
http://www.news.harvard.edu/gazette/2001/01.24/01-stoplight.html
The light dims as it slows down, so you think that it's being turned out. Then Hau shoots a yellow-orange laser beam into the cloud of atoms, and the light emerges at full speed and intensity.
2) http://www.jpl.nasa.gov/releases/2003/73.cfm NASA-funded research at Harvard University, Cambridge, Mass., that literally stops light in its tracks, may someday lead to breakneck-speed computers that shelter enormous amounts of data from hackers. .... When they shot a light pulse into the cloud, it bogged down, slowed dramatically, eventually stopped, and turned off
eagle,
the problem is that there is hostility on both sides, one on the concept of proving einstein wrong, which is what a lot of people feel is the justification rather than the concept of scientific discovery and advancement. Just look at the title of the article/seed, it starts with 'Einstein wrong again!' which is incorrect from the start because GTR has yet to be proven wrong ever at this point. There are experiments that indicate that it may not explain everything, but there is NO indication that it is wrong.
Now if people would start to talk like adults in matters, then we wouldn't be going through this with the hostility that we seem to be here, but on the other side, the same thing happened about a hundred years ago when Einstein first came out with the theory of relativity, but unlike then, we don't seem to have a new theory, just data points.
- 3 votes
Jonathan-1917156 ok " One can not prove a NEGATIVE ", so then a Theory is to be proved Right, no one needs to prove it wrong.
So when a Theory does not meet the needs to be " right " then the Scientific method is that it remains a Theory till it is.
SO once again we are back to " Faith " and My initial article here it is once again http://eagleaverro.newsvine.com/_news/2011/05/19/6678872-what-is-evolution-and-what-defines-a-religion?threadId=3138692&commentId=55825370#c55825370
The premise made there is fitting for all " Science Dogma " and hence all " religions " are whatever one CLINGS to that has NOT been fully verified and hence needs an element of Faith.
Eagle,
I doubt very much that anyone will EVER prove Relativity. Why? because you can test 10 billion hypothesis, and everyone of them will fit within the theory of relativity, but only one failure will disprove it. More than likely, what will happen, because so much 'testing' has been done on relativity, is that it will be proven to have limitations, just like newtonian physics, which is still taught, is considered to be right, when you factor in its limitations, where Relativity takes over.
It is the same thing with evolution,
The problem with religious doctrine is that it is untestable, relativity is testable, and that is what differentiates religious faith and science.
- 4 votes
Jonathan-1917156 So you say, i say different about the Bible and I am sure you have read a number of comments I have made on it, but like anything " written by Man " and as of this Moment i do not know of any book written by any other creature but Man. I believe a university has supplied Primates with Tablets,( Computers ) so lets wait and see lol but I am More then comfortable in proving the Genesis Chapter 1 is Scientific.
So called contradictions are what a true Scientist will understand a " locality based perceptions " and not lies or misinformation.
A Veriance in a time line that does not change the probabilities and final outcome is just procedural.
@Eagle Averro: You obviously want somebody to argue with. I'm not that person. Have a nice evening.
- 5 votes
Thank You for the scientific response to t eh articles posted, yes may you have a great day also.
Jonathan-1917156 ok " One can not prove a NEGATIVE ", so then a Theory is to be proved Right, no one needs to prove it wrong.
One can't prove that something doesn't exist because it's impossible for something that doesn't exist to leave behind evidence. As an example, you can't prove God doesn't exist. One can, through evidence and experimentation, prove that there are conditions under which a theory fails.
The premise made there is fitting for all " Science Dogma " and hence all " religions " are whatever one CLINGS to that has NOT been fully verified and hence needs an element of Faith.
Trying to equate the kind of faith required to accept a scientific theory and religious faith is absurd. It also show, once again, that you really don't understand what science is.
You accept a theory knowing that it is based on the best scientific evidence available at the time. You know that the theory is subject to change as new evidence and insight emerges and you are welcome to test the theory yourself.
Religious dogma is not based on any evidence at all. Christians take it on faith that the contents of a book, whose origins can't be proved, are the literal truth. Although people have found evidence that some of the people, places and events actually occurred (though often not exactly in the way that the Bible describes), no one has yet found a way to prove the spiritual aspects of the book. In some sects and periods in history, such testing results in the follower being ostracized, ejected from the sect, imprisoned or even killed.
- 4 votes
While I was inclined to giving you the benefit of the doubt, I figured any attempt to debates you on your opinions would be a waste of time.
- 3 votes
Science is Man's efforts of understanding God's ways!
The ultimate weeny-shrinker when it comes to discussing science. Seeding this article in that way is blatant trolling.
- 5 votes
No.
What seems to be true is that you posted a science article with the sole intent to discuss religion.
science, milky-way-galaxy, special-relativity, earth-spins
those were your tags. Normally, this would justify a report to the moderators. You're just so new to NV, though,.........
- 6 votes
Does any one get the feeling that Sky has an " Axe to grind "? and is making threats to Viners?
- 1 vote
Einstein must be kicking himself in the grave these days....................
another false prophet of Science!
another false prophet of Science!
I'd just point out that Einstein has not 'been proven wrong', that science has tripled your life expectancy in just the last 100 years or so (if you're over the age of 30, odds are you'd be dead by now), and that computer you're typing on was created by the False Prophets Of Science.
Arrogance and ignorance are unattractive qualities - and certainly not ones that were promoted by either Jesus or our Founding Fathers.
- 8 votes
Once there was an Aristotle!
and for nearly 2 Millennia, he made humans believe in Spontaneous Generation.
Because of his limited observational ability!
Where is that belief now?
You see its not about Aristotle or about Einstein!
Its about Science...............
What caught my attention was the sensationalism of the the title.
"Einstein wrong again!" - Umm, not yet but there are a lot of people watching!
"New experiment confirms doubts over his speed of light theory" - Confirms doubts?? People have always held doubts, as we should.
As for the topic, I'm waiting (anxiously) for more data.
- 3 votes
Any electron neutrino can routinely exceed the local speed of light, and it's affect, and the affect it has on other electrons it hits and propels faster than the local speed of light, creates the cerenkov effect, the characteristic blue glow in a reactor. I'm wondering what experimental regimen was followed to assure, 1) that the electrons in the experiment were really travelling in a vacuum that would not result in a slower local speed, and 2) that the neutrinos used in the experiment really exceeded the absolute speed of light.
I'm sure the math, and the regimen taken to insure experimental purity, are mind-boggling to the layman, but until the experiment is replicated in another facility, with different local factors, I think this is still a work in progress.
Note to Jonathan, if you're still around. I don't think the LHC was the instrument used for this experiment. The article seems to have steered one away from that conclusion.
- 2 votes
Mr G well said Science is ALL about " Doubt " Did you read the articles about Light Speed and how it is not a constant as some " Fanatics " claim it to be?
- 1 vote
Did you read the articles about Light Speed and how it is not a constant
This seems to be new to you. Congratulations.
Most people familiar with high school science already know that C is the speed of light in a vacuum.
Try checking Wikipedia. It's the very first sentence.
http://en.wikipedia.org/wiki/Speed_of_light
Detracking this article due to anti-science religious trolls. DNFTT
- 5 votes
MarkD-555 " Detracking this article due to anti-science religious trolls. DNFTT " calling Viners trolls only shows your limitation obviously you did not read the articles, but i will assist you as far as possible, do you consider space as a " vacuum " if yes see " Gravity lensing "
Do you know how light in a Vacuum tube is redirected using magnetism? if not study on it.
Science can not make advances when " close minds " make definitive statements about Fundamental we know near ZERO about!!! See Photonics.
Eagle - Mr. G says the scientific method removes doubt in order to accurately explain a phenomenon. A belief has no value in this context until there is data to support it.
I'm waiting for repeatable experiments and peer reviewed data to support the claim.
- 3 votes
Einstein did say that speed greater than the speed of light could be achieved. What is confusing is that he said that speed at the speed of light could not be achieved.
The problem arose out of the fact that the divisor became zero at the speed of light and we cannot divide by zero, which makes speed at the speed of light impossible. For speeds greater than the speed of light the divisor has a negative integer, which allows for speeds greater than the speed of light, indeed possible.
Given these facts which are well known, makes me wonder why these articles keep coming up.
- 3 votes
Yes the speed greater than the speed of light could not be achieved according to Einstein's limited understanding of the Universe...............
The article is from November. I thought I'd read somewhere that the discrepancy had been resolved; that it was a relativity problem and not a speed of light problem. Thus, it actually confirmed Einstein, yet again.
I can't remember where I read that. Did anyone else come across it?
- 2 votes
Speed of Light is ANY speed light travels " c" is a constant same as a Mile or a Kilometer!!!
http://www.news.harvard.edu/gazette/2001/01.24/01-stoplight.html
The light dims as it slows down, so you think that it's being turned out. Then Hau shoots a yellow-orange laser beam into the cloud of atoms, and the light emerges at full speed and intensity.
http://www.jpl.nasa.gov/releases/2003/73.cfm NASA-funded research at Harvard University, Cambridge, Mass., that literally stops light in its tracks, may someday lead to breakneck-speed computers that shelter enormous amounts of data from hackers. .... When they shot a light pulse into the cloud, it bogged down, slowed dramatically, eventually stopped, and turned off
- 1 vote
Fine, "c", but everyone knows what we're talking about. Even the article uses the layman's term speed of light. It isn't always necessary to add the "in a vacuum" bit, now is it?
At any rate my question was answered before I even posted it. Somehow I missed Physicist Retired's #1.14 post about the special relativity solution.
And yeah, the light slowing experiments are cool. The last one I was following used water, been a while now.
- 3 votes
Eagle, I'll just assume you meant to post that elsewhere since it wasn't even addressing the question and way off subject. But thanks for the old links regarding light anyway.
I thought I'd read somewhere that the discrepancy had been resolved; that it was a relativity problem and not a speed of light problem. Thus, it actually confirmed Einstein, yet again.
I can't remember where I read that. Did anyone else come across it?
Last I read the 58-60 nano second "faster than light result" was due to not accounting for the time dilation of the satellites tracking the experiment. The time dilation due to the speed differential vs the ground was calculated to be about 64 ns.
http://www.forbes.com/sites/alexknapp/2011/12/28/new-evidence-casts-doubt-on-faster-than-light-neutrinos/
But here is the most useful link I have found, detailing the entire timeline of the results and problems with links to many stories on it.
And pro tip to you anti-science people. Einstein could very well be "wrong" in that one particle goes FTL. Big deal. All his formulas will still be used. He still has major results in applied technology that we use daily. We wouldn't have satellites, GPS systems, or nuclear power if he wasn't "right".
The Bible is wrong all the time, and it's chalked up to "Poetic license" because it can't afford to ever be acknowledged as wrong to some.
And now back to your regularly scheduled anti-science religious ranting.
---
At any rate my question was answered before I even posted it. Somehow I missed Physicist Retired's #1.14 post about the special relativity solution.
Oops, I missed it too. Had Biotronics on ignore.
- 3 votes
Yes it IS, but even adding that does not make it Right, let me ask you thism do You think Space is a " vacuum"?
let me ask you thism do You think Space is a " vacuum"?
Is this a Jr. High science test? Or are you just making a lame attempt to prove someone wrong on technicalities?
- 4 votes
Thanks for the response, Mark.
Eagle, no I don't think space is a perfect vacuum, but that's how c is defined is it not? The propagation rate of electromagnetic radiation in a theoretical "vacuum"? But, I suppose it's all relative...
edit- 3 minutes late, thanks for the response again, Mark. ;-)
- 3 votes
dignitatem societatis Are You MarkD-555 also? if not, seems Mark has a personality disorder!
right it s " relative " because a formula cannot work with a constant variable. so then is is an assumption to make a formula work Rather then a scientific fact, that so many mistake it for.
dignitatem societatis Are You MarkD-555 also?
Nope.
right it s " relative " because a formula cannot work with a constant variable. so then is is an assumption to make a formula work Rather then a scientific fact, that so many mistake it for.
Actually, I was being rhetorical there. Are you saying you think c is bunk?
- 1 vote
do You think Space is a " vacuum"?
Space is as close to a perfect vacuum as you can find. On average, the density of the universe is two hydrogen atoms per cubic meter. Of course that is not evenly distributed, so local to accumulations it will be higher, and in intra-galactic areas, lower.
- 2 votes
no "c" is a reality same as a Mile and a Kilometer are realities, what IS a " Bunk " is that " Light speed is a constant " anywhere including a " Vacuum".
And as You might have noticed earlier those that " Arse U me " different leave themselves open to be arse u mers :-)
I don't actually think there are scientific doubts over the speed of light limit.
As the article clearly said : "
The results have only dealt with some possible errors.
'There are still a number of other possible errors and uncertainties that they are working on ruling out."
And, more importantly, the only facility where this issue came up is the same facility where the follow-up tests have been conducted. No other facility, before or since has reported such a finding.
Odds are it's a measurement of distance problem.
- 2 votes
So far Einstein lovers have effectively proven that Warp speed cannot be achieved and the humans will always remain stuck in the solar system because their prophet said so!..................
Bio, and all the people around the world have thus far failed to build or demonstrate anything along the lines of FTL propulsion -- despite every possible incentive imaginable.
It's not that Einstein said so. It appears that nature said so, and Einstein was one of the first to notice it.
- 4 votes
I'm a genetic engineer!...........
I make clones of God's creations by copying His Intelligent Design in the lab!
Bio, sorry, my English is sometimes a bit lacking.
I meant to put Bio,
and then put the body of the response which was "And all the people around the world...".
Sorry for the ambiguities.
- 1 vote
Seems that the" Dogmatic Religious Fanatics " cannot take in ANY science and ANY new findings, has that not always been so ;-)
No wonder, ultra liberal atheist scientists have failed to prove that God exists, because are soooooooo DUMB!
Biotronics to travel the Universe, one does not need greater speed. nor need to " bend space " (warp) Space is fine without the need to be WARPED by puny humans, what we need for Universe travel is better use of TELOMERASE, read up on it, but change the misuse of the word " Immortal " to a better word " eternal "
EA is presuming that immortality from general cell death is the key.
Of course, travelling a few hundred-thousand years or to another galaxy, for example, would still require feeding the cells. That means food and water, in copious amounts.
Wouldn't a month of food weigh about as much as the person. So a small trip of maybe 150,000 years would take about as many tonnes of food. With life-support, that would require a great deal more energy/fuel unless you use some suspended animation (which would eliminate the need to improve telomeric snippage).
Plus, it would destroy all world economies.
- 1 vote
I'm a genetic engineer!...........
I make clones of God's creations by copying His Intelligent Design in the lab!
The Genetic Code: Coincidence or Intelligent Design?
The genetic code has been called the blue print of life on Earth. It is defined as a sequence of three consecutive nucleotides, called codons, within the coding region of a gene, that are translated in to an amino acid in the resulting gene product or protein. The Central Dogma of Biology revolves around this basic concept of nucleic acids carrying genetic information through codons that are transcribed and translated into the building blocks of functional proteins which then conduct the business of life such as communication, growth and reproduction.
The three lettered genetic code has governed the existence and propagation of all known Life on Earth since the prehistoric times. The code may be a little wobbly and a little redundant, but it has controlled all life on the Planet Earth through all Eons. From single celled microbes in the primordial oceans of the prehistoric Earth to dinosaurs and redwoods to monkeys and humans (and their viruses!), those three lettered codons have dictated the insertion of each and every amino acid in the proteins of all known life forms. The genetic code has withstood the test of Time by surviving rather than evolving through the harshest of environmental changes, i.e., from electromagnetic radiation storms to the toxic volcanic eruptions, to droughts and floods that wiped out nearly all life on Earth many times during its violent history. Yet, it was the same three lettered code, giving rise to the same 20-22 amino acids containing proteins, that resurrected life over and over in its various known forms, i.e., viruses, microbes, plants, animals and humans each well suited to their respective environment. Thus, one is justified in saying that despite its universality, the genetic code has an unlimited transformative potential in the face of all kinds of environmental insults. Is this a mere coincidence or an Intelligent Design?
On a different note, one must ponder, whether the Morse code is the creation of an intelligent being or it just came into being on its own? Is the Binary code of the Digital world a fluke of Artificial Intelligence or an Intelligent Design? As Genetic engineers and architects of modern life, can scientists design/create a brand new genetic code intrinsically different from the existing one, which could give rise to new life forms, fundamentally (and genetically!) different from their predecessors?
Bio, argument from ignorance?
Actually, the problem is that the genetic code doesn't carry a message.
The genetic code HAS evolved. It has not withstood the test of time. Look at the UUU and UUC coding for Phe, and UUA and UUG coding for Leu. But Met only being coded by AUG, and STOPs being coded by UUA, UAG, and UGA.
It is clearly evolved, since mitochondria use them to code for different items.
- 3 votes
"It is clearly evolved, since mitochondria use them to code for different items".
I did mention the Code's degenerate nature!
That's part of the Intelligent Design, newby!
Did you think God was dumb enough to create only once and not think about Quality Improvement?................
Besides, Mitochondria still use the 3 letter code, dont they?
Its not 3.5 03 2.5 letters or made up of sugars instead of nucleotides!..............
Yes, it does use 2 or 2.5 actually.
If some are coded by basically the first two codes, where ANYthing as the third code is ignored, then YES, it's that not all the codes use 3 codes.
- 3 votes
the third letter is NOT ignored! If it is, the resulting protein will loose its amino acid integrity and the mitochondria will die.................
Third letter Wobble is a beautiful example of ID which allows diversity and flexibility
Third letter wobble fails on Met which only has AUG.
Third letter is ignored on Leu and Val. C+U+anything codes for Leu. G+U+anything yields Val.
And Ser is coded by U+C+anything -- oh, also by A+G+U and A+G+C.
Each codon needs two base-pairs (at least) and the third might be ignored (like Leu and Val and Arg and Gly and Ser (sometimes)).
Yeah, that would be called half-coding by everyone else.
Research shows that if other codon (non-triplet) sizes are used, they will almost definitely evolve to a low of 3 base-pair codes.
See www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0005708
A mathematical model for Codon Size Reduction as the Origin of the Triplet Genetic Code.
Sorry, but representing 20ish items in an array that holds 64 items, with the way it clearly does does strongly appear to be UN-intelligently designed. It's not even just random, but more -- the result of evolution, it would seem.
- 4 votes
There are only 8 amino acids (out of 20-22) that have a degenerate code, where you can replace any letter at the third position. The rest (including Methionine) have either just a single codon or a maximum of two.
Try the following example:
ATGAGGGCCTGGATCTTCTTTCTCCTTTGCCTGGCCGGGAGGGCCTTGGCAGCCCCT
M R A W I F F L L C L A G R A L A A P
If you ignore the third letter in any of the above code, it will be read as part of the next codon. if you read the third codon (GCG for A) as GC instead of GCC, then the next codon will become CTG instead of TGG and will code for Leucine instead of Tryptophan (W) and so forth.
Sorry the formatting is off in this message, so u will have to arrange all AA letter under the 3 letter codons.
This sequence BTW is genuine and can be seen here along with its original genetic code
Biotronics lol only Two are Used and the Third Ignored :-) it is a bit like writing a check with $1200998 and what YOU meant was $12998 because the ZEROS are to be Ignored, lol what Ignorance!!
Bio, so, about half the coded-for function (not just amino-acids, but stops too) have multiple values, right? Some have one. So that would mean that YES it is a variable number, ie., 2.5 bits effectively. The third bit is, in not merely 8 amino-acids, but more importantly, in 32 of the 64 codon sequences, entirely ignored (half). And further, it's half-ignored for another 24 codon sequences.
So it's 2.5 bits (about) for about 56 out of the 64. MOST of the codes have one bit entirely ignored or half a bit ignored.
Why have even two codon sequences code for the same amino acid? Why have four? Why NOT have the same number for each? Some have only one valid coding sequence like Met or Trp. Even in those groups we have Met sharing a THREE-version copy of Ile, but Trp shars the UG group with Cys and a stop codon! So there's not even symmetry. And the Stop codons are sprinkled throughout.
Sorry, that's clearly not design, that's evolutionary co-opting.
I am not saying that you can DELETE the third one, but that it's not significant, can be entirely ignored.
Of course, we DO have further evidence of changes over time, because not all codons are standard across all species.
CUG codes for leucine, right... except when it codes for Serine. So, it's not really standard is it.
See www.ncbi.nlm.nih.gov/pubmed/10188281
( Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida )
or lots of examples of differences :
www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi
( The Genetic Codes ) -- same domain as your example.
So, there is no actual evidence of intelligent design in the "test of time" for DNA when we CAN actually see changes over time to the actual CODES of the code.
- 4 votes
Ignoramuses!
If you would to educate yourself properly, on the Genetic Code, please check out some free online links at the MIT free educational resource by typing in genetic code and MIT in the google search box. there is a whoe host of information out there.......
http://web.mit.edu/shalevi/www/review_NG_genetic_code.pdf
ORIGINAL RESEARCH PAPER Itzkovitz, S. & Alon, U. The genetic code is nearly optimal for
allowing additional information within proteincodingsequences. Genome Res. 9 February 2007(doi:10.1101/gr.5987307)
FURTHER READING Condon, A. Designed DNA molecules: principles and applications of
molecular nanotechnology. Nature Rev. Genet. 7,565–575 (2006)
Otherwise please seek admission in BIO-101 at your nearest community college
The Genetic Code in a Nutshell!
http://scienceblogs.com/oscillator/2010/02/expanding_the_genetic_code.php
Bio, did you refute ANY of the points in my posting?
None, absolutely NONE were remotely inaccurate.
Your claim was that the code itself wasn't evolving.
Your NG Genetic Code comes to the same conclusion as does the paper that I cited :
www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0005708
A mathematical model for Codon Size Reduction as the Origin of the Triplet Genetic Code.
And even the codes themselves have changed, over time, which amino-acid they actually code for.
Come on, be specific, which assertion of mine was incorrect.
I've already shown where your intelligent design assertions were bogus, and even shown your ID posting to be an argument from ignorance, and a speciously contrived one at that.
- 3 votes
As for ID,
If you ever get a chance, go to Mount Rushmore and ask yourself this question!
Was this monument designed and created by Intelligent beings or did the Wind and Rain caused it to be!
Bio, the candida and all those others were human assisted evolution?
Wow, seriously, Paley's watchmaker canard again?
Look at ice -- it's self assembling. Look at planetary systems or stars, they also self-assemble.
Rushmore conveys an intentional meaning OVER and above the simple information that it contains. Ice doesn't. DNA doesn't. DNA merely carries the natural chemical processes that helped form it... like a scab, or like adding an acid to a base.
Your assertion was false -- you said that DNA, as a code, was not evolving. The conclusion of the CUG codon study I cited was that " Our result suggests that non-universal decoding is not a rare event, and that it is widely distributed in the genus Candida."
So, it is and has changed in bacteria, and in mitochondria (likely also evolved from bacteria) and DNA acts precisely as if it had evolved, EVEN down to the codon size of triplets.
Everything you've posted, in fact, asserts the same.
- 4 votes
Please provide the DNA sequence of a gene in which the code is not "Triplet" and you shall be awarded a Noble Prize...... You need to provide the sequence of the resulting protein as well of course!.
The cellular machinery of all living organisms (as well as extinct dinosaurs!) is incapable of reading or translating any code that is less than a Triplet.
WOW!!! Someone Claims to know Protoplanet formation.. WOW, this one is indeed destined for a Nobel!!! lol
"Look at ice -- it's self assembling. Look at planetary systems or stars, they also self-assemble".
That's because that's how some Intelligent Being has DESIGNED/programmed them to be!
The Holy Quran: Chapter 21 (the Prophets)
[21:30] Do the unbelievers not realize that the heaven and the earth used to be one solid mass that we exploded into existence? And from water we made all living things. Would they believe
[21:33] And He is the One who created the night and the day, and the sun and the moon; each floating in its own orbit.
The Holy Quran: Chapter 30
[30:11] GOD is the One who initiates the creation and repeats it. Ultimately, you will be returned to Him.
[30:22] Among His proofs are the creation of the heavens and the earth, and the variations in your languages and your colors. In these, there are signs for the knowledgeable.
[30:29] Indeed, the transgressors have followed their own opinions, without knowledge. Who then can guide those who have been sent astray by GOD? No one can ever help them.
The Holy Quran: Chapter 36 (Yaasin)
[36:80] He is the One who creates for you, from the green trees, fuel which you burn for light.
[36:81] Is not the One who created the heavens and the earth able to recreate the same? Yes indeed; He is the Creator, the Omniscient.
[36:82] All He needs to do to carry out any command is say to it, "Be," and it is.
[36:83] Therefore, glory be to the One in whose hand is the sovereignty over all things, and to Him you will be returned.
Oh, you are now claiming that the ONLY thing that hasn't changed was the number of items in the codons? You now accede that the DNA codons themselves have evolved and want to argue the codon SIZE? Ok, I will play with your moving goal-posts.
Did you read the study that you cited on codon size, OR the one that I'd cited? They both assert that evolution would guarantee a triplet size, regardless of original codon-size (be it 5 base-pairs or 4 or whatever).
Ok, How about the AGGY or CCCCU codons?
I think that AGGY doesn't qualify as a triplet -- as it is FOUR base-pairs. It's very close to three, but adding one to three yields four. And since four does not equal three, then it destroys your proposition.
Anyone with competent training in computational bioinformatics or molecular biology should remember that.
A NOBLE prize? Ok, sorry, you're not any sort of scientist, as is clear. It is Nobel. Noble is a word, a descriptor of behaviour or measure of comparative virtue. While some names are also words, Nobel is rather a cultural icon.
- 4 votes
Ok Chirmly,
No Noble Prize for you.
Would you settle for an Ig-Noble Prize?
The typo was Intentional!
I think that AGGY doesn't qualify as a triplet -- as it is FOUR base-pairs. It's very close to three, but adding one to three yields four. And since four does not equal three, then it destroys your proposition.
Like I said earlier, plz. provide a real life example in a gene-protein context.
In God We Trust, All Others, Bring Evidence!
Bio, That is in a real life example -- it's in Perkinsus marinus... and AGGY codes for glycine. CCCCU codes for proline.
See www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0019933
Or see nar.oxfordjournals.org/content/38/18/6186.full
- 4 votes
Chirmly,
http://nar.oxfordjournals.org/content/38/18/6186.full.pdf+html
This is an example of extensive frameshifting, which is a common phenomanon, however, notice that the Triplet Codon integrity is still maintained.
If you look closely in fig. 2A and notice that every time the ribosome reaches the seq. AGGU (shown in red) it skips A and reads the next 3 letters GGU to add Glycine instead of Arg (AGG) and keeps adding the next few AAs in this modes until it shifts frame again by 2 letters at CCCCU (blue) to read CCU and add a proline and so on. so in all the ribosome has skipped a total of 3 nucleotide to maintain the integrity of the triplet code each time! (read the grey shaded AAs)
Nowhere in this figure, has the triplet code been breached. All amino acids have been read in triplet code motif, despite the fact that extensive frameshifting has occurred. Overlapping genes in many viruses also adopt the same strategy but it does not compromise the integrity of the triplet code!
Thanks for the paper though, I will ask my students to discuss it in next week's Journal Club!
Bio, but the codon is still preserved.
Oh, and are you saying that the next part of the codon is not significant? Hmm.. kind of like the current one-way degenerate codes I'd mentioned above?
You can't have it both ways.
You said that DNA never evolved.
Then I showed that it did, and that codons now do not code for the same things they always had.
Then you said that it was always three codons.
And I showed you non-triplets which are conserved, showing they WERE longer in the past.
Those are examples of codons with more than 3 base-pairs that you asked for.
- 4 votes
Chirmly,
You have not showed me any Non-triplet codes! as I have made very clear in the above post. You may also discuss it with a Molecular geneticist near you.
and plz. STOP twisting my words, I never said that DNA never evolved! I was talking about the Triplet nature of the Genetic Code, and it has remained the same so far.
This is what I said in that post:
Yet, it was the same three lettered code, giving rise to the same 20-22 amino acids containing proteins, that resurrected life over and over in its various known forms,
"the same three lettered code" means that its always been the triplet code (not duplex or quadruplex etc.)
"the same 20-22 AAs" means the same set of 20-22 amino acids found in all proteins. Although there are 200 plus known amino acids out there.
Let talk about Einstein again, If you haven't run out of steam yet!
Bio, here's the snippets from the papers :
"Masuda et al. [20] suggest two feasible mechanisms for the translational frameshifts in Perkinsus: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons (similar to the model hypothesized by Beckenbach et al. [42]), or specialized tRNAs recognizing non-triplet codons AGGY and CCCCU to code for glycine and proline, respectively. In this study, we add cox1 for P. chesapeaki and cob sequences for P. marinus and P. chesapeaki, which share the unusual AGGY codon with cox1 and use other unusual codons (UAGGC and UCGGU) to encode glycine as well. Specialized tRNAs in the Perkinsus mitochondrial system recognizing non-triplet AGGY and CCCCU codons, and likely UMGGY as well, may be more likely than the ribosomal frameshifting scenario, as naturally occurring tRNA mutants suppress +1 frameshifts via an extended anticodon loop in Escherichia coli (e.g. [43]), and quadruplet codons are used in protein mutagenesis"
Sorry, but those are clear references to non-triplet codons.
And there is also www.ncbi.nlm.nih.gov/pubmed/10764591 ( Quadruplet codons: implications for code expansion and the specification of translation step size )
So, it seems that it's not merely my slant on this.
And another study shows "The length of codons in the genetic code is also optimal, as three is the minimal nucleotide combination that can encode the twenty standard amino acids. The apparent impossibility of transitions between codon sizes in a discontinuous manner during evolution has resulted in an unbending view that the genetic code was always triplet. Yet, recent experimental evidence on quadruplet decoding, as well as the discovery of organisms with ambiguous and dual decoding, suggest that the possibility of the evolution of triplet decoding from living systems with non-triplet decoding merits reconsideration and further exploration. "
In fact, non-triplet codons are the basis of this entire paper :
( Codon Size Reduction as the Origin of the Triplet Genetic Code ) at www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0005708
I have given codons which are not three base-pairs, and they were actually called codons by the actual writers of multiple papers (not just me).
And finally, there are papers showing evolutionary evidence of the genome from non-triplet DNA.
- 3 votes
Masuda et al. [20] suggest ...the model hypothesized by Beckenbach et al. [42]), ..may be more likely than the ribosomal frameshifting ... may be more likely than the ribosomal frameshifting
LOL at " Sorry, but those are clear references to non-triplet codons. " lol Seems reading and comprehension is not, a NOBLE training for someone that wants a NOBEL prise, Most Ignoble, indeed.
Seems reading and comprehension is not,
The topic of the quoted piece is the mechanism involved, not the likelihood of the codons themselves.
- 2 votes
Chirmly,
And there is also www.ncbi.nlm.nih.gov/pubmed/10764591 ( Quadruplet codons: implications for code expansion and the specification of translation step size )
This is human engineered Genetic Code, (what I had eluded to in the last para of the Genetic Code piece earlier)
As Genetic engineers and architects of modern life, can scientists design/create a brand new genetic code intrinsically different from the existing one, which could give rise to new life forms, fundamentally (and genetically!) different from their predecessors.
Human engineered codes will only work with human engineered tRNAs and human engineered Ribosomes, and human engineered Amino acids and human engineered elongatioon factors and the whole slue of human engineered portein synthesis machinary!
If Humans can engineer such a feat, it will be Non-transferable to the rest of life forms because of functional incompatibility.
You're in Easy Mode. If you prefer, you can use XHTML Mode instead. |



